html текст
All interests
  • All interests
  • Design
  • Food
  • Gadgets
  • Humor
  • News
  • Photo
  • Travel
  • Video
Click to see the next recommended page
Like it
Don't like
Add to Favorites

Геномика: постановка задачи и методы секвенирования

Методы определения последовательности нуклеотидов в молекуле ДНК

Сергей Николенко, сотрудник лаборатории вычислительной биологии Санкт-Петербургского Академического Университета, в серии статей говорит о некоторых задачах биоинформатики, связанных со сборкой и анализом геномов, делая акцент на математической, комбинаторной постановке задачи. В данном вводном тексте речь идет о том, как выглядят входные данные для сборки геномов и как их получают. 

Как выглядит молекула ДНК?

Начнем с того, как выглядит молекула ДНК. Молекулы полимеров характеризуются первичной структурой, под которой понимается просто состав молекулы (в данном случае – последовательность букв A, C, G и T, которые и составляют геном), вторичной структурой, т.е. тем, какие именно химические связи устанавливаются между этими компонентами и какие в результате получаются базовые пространственные структуры (в данном случае – двойная спираль), и третичной структурой, т.е. тем, как вторичная структура «уложена» в пространстве. Вторичная структура ДНК представляет собой двойную спираль, состоящую
из четырёх разных нуклеотидов. Нуклеотиды обозначаются по содержащимся в них азотистым основаниям: аденину (A), цитозину (C), гуанину (G) и тимину (T) (есть ещё урацил, который в РНК заменяет тимин), и в дальнейшем мы всегда будем пользоваться этими буквами. В двойной спирали эти аминокислоты связаны друг с другом водородными связями, и связь устанавливается по принципу комплементарности: если в одной нити ДНК стоит A, то в комплементарной нити будет T; а если в одной нити C, то в другой будет G. Именно это позволяет относительно просто проводить репликацию (копирование) ДНК, например, при делении клетки: для этого достаточно просто разорвать водородные связи, разделив двойную спираль на нити, после чего парная нить для каждого «потомка» автоматически соберётся правильно. Важно понять, что ДНК – это две копии одного и того же «текста» из четырёх «букв»; «буквы» в копиях не идентичны, но однозначно соответствуют друг другу. Например:

ATGCAGAACAGACGATCAGCGACACTTTA
TACGTCTTGTCTGCTAGTCGCTGTGAAAT

Было бы, конечно, удобно, если бы нам удалось аккуратно «вытянуть» одну нить ДНК и спокойно, нуклеотид за нуклеотидом, «прочесть» эту нить от начала до конца. При таком идеальном методе секвенирования (чтения ДНК) никаких хитрых алгоритмов не понадобилось бы. К сожалению, на данном этапе такое невозможно, и приходится довольствоваться результатами того секвенирования, которое есть.

Что такое секвенирование?

Секвенирование (sequencing) – это общее название методов, которые позволяют установить последовательность нуклеотидов в молекуле ДНК. В настоящее время нет ни одного метода секвенирования, который бы работал для молекулы ДНК целиком; все они устроены так: сначала готовится большое число небольших участков ДНК (клонируется молекула ДНК многократно и «разрезается» её в случайных местах), а потом читается каждый участок по отдельности.

Клонирование происходит либо просто выращиванием клеток в чашке Петри, либо (в случаях, когда это было бы слишком медленно или по каким-то причинам не получилось бы) при помощи так называемой полимеразной цепной реакции. В кратком и неточном изложении работает она примерно так: сначала ДНК денатурируют, т.е. разрушают водородные связи, получая отдельные нити. Затем к ДНК присоединяют так называемые праймеры; это короткие участки ДНК, к которым может присоединиться ДНК-полимераза – соединение, которое, собственно, и занимается копированием (репликацией) нити ДНК. На следующем этапе полимераза копирует ДНК, после чего процесс можно повторять: после новой денатурации отдельных нитей будет уже вдвое больше, на третьем цикле – вчетверо, и так далее.

Все эти эффекты достигаются в основном с помощью изменений температуры смеси из ДНК, праймеров и полимеразы; для наших целей важно, что это достаточно точный процесс, и ошибки в нём редки, а на выходе получается большое число копий участков одной и той же ДНК. Разные методы секвенирования отличаются друг от друга не методами клонирования, а тем, как потом прочесть получившийся «суп» из многочисленных копий одной и той же ДНК.

Секвенирование по Сэнгеру

Первым методом секвенирования, который учёные сумели применить для обработки целых геномов (в том числе генома человека), стало секвенирование по Сэнгеру (Sanger sequencing). Смысл таков: участок ДНК клонируется, после чего полученная смесь делится на четыре части. Каждая часть помещается в активную среду, где присутствуют:

(1)   ДНК-полимераза, которая, как мы уже выяснили, занимается репликацией,

(2)   праймеры, необходимые для начала процесса репликации,

(3)   смесь всех четырёх нуклеотидов, которые будут служить «кирпичиками» для строительства новых копий ДНК,

(4)   и, главное, специальные вариации одного из нуклеотидов (ровно один вид нуклеотидов для каждой части), которые прекращают дальнейшее копирование молекулы ДНК.

Собственно, процесс практически идентичен клонированию ДНК, с которым мы встретились в предыдущем разделе. Разница только в том, что теперь в один из нуклеотидов подмешаны «ложные» нуклеотиды; они могут образовать точно такую же водородную связь, но не могут продолжить свою нить дальше.

В результате в каждой части образуется большое число копий префиксов исследуемого участка ДНК, которые имеют разную длину, но всегда заканчиваются на одну и ту же букву – в зависимости от того, когда повезёт взять в процесс клонирования «ложный» нуклеотид. Например, в пробирке, где все последовательности заканчиваются на Т, из нашего примера выше получилась бы смесь из следующих префиксов:

ATGCAGAACAGACGATCAGCGACACTTTA (образец)
AT
ATGCAGAACAGACGAT
ATGCAGAACAGACGATCAGCGACACT
ATGCAGAACAGACGATCAGCGACACTT
ATGCAGAACAGACGATCAGCGACACTTT

Как теперь, получив такую смесь, «прочесть» геномную последовательность? Заметим, что в сумме в четырёх пробирках мы получили все возможные префиксы интересующего нас участка. Это значит, что если мы сможем просто измерить длину каждого префикса (точнее говоря, даже не измерить, а просто упорядочить, узнав, кто из них длиннее), то мы сможем узнать и последовательность тоже. Предположим, что мы увидели, что в пробирках лежат префиксы вот такой длины (по порядку, от самого лёгкого 1 до самого тяжёлого 10):

A C G T
1, 5, 7, 8, 10 4, 9 3, 6 2

Очевидно, что эта последовательность начинается с А (т.к. самый лёгкий префикс, из одной буквы, заканчивается на A); дальше идёт C, дальше опять A, и так далее. В результате можно прочесть исходный участок: ATGCAGAACA.

А чтобы измерить длину, можно, например, измерить массу всех префиксов во всех пробирках. Чтобы измерить массу, можно, например (разные секвенаторы использовали разные процедуры, но суть от этого не меняется), ионизировать эти молекулы и отправить их наперегонки к заряженному электроду в специальном геле, который создаст трение и замедлит продвижение молекул – этот метод называется электрофорезом. При одинаковом заряде более тяжёлые молекулы будут двигаться медленнее, и в результате получится примерно такая картинка. Видно, что (в идеальном случае) можно просто прочесть последовательность нуклеотидов от самого лёгкого префикса (т.е. префикса из одной буквы) к самому тяжёлому.

Результаты и ошибки сэнгеровского секвенирования

На выходе из сэнгеровского секвенатора получаются короткие участки ДНК, так называемые риды (reads). Для биоинформатики принципиальны две вещи: во-первых, какой длины получаются риды, во-вторых, какие в них могут быть ошибки и как часто (разумеется, на свете нет ничего идеального).

Сэнгеровские риды по этим критериям очень хороши: получаются риды длиной около тысячи нуклеотидов, причём качество начинает заметно падать только после 700-800 нуклеотидов. Сам процесс секвенирования по Сэнгеру, с которым мы познакомились в предыдущем разделе, предопределяет и эффект падения качества (труднее отличить молекулу массой 700 от молекулы массой 701, чем массу 5 от массы 6), и другой неприятный эффект – если в геноме встречается длинная последовательность из одной и той же буквы (…AAAAAAAA…), трудно бывает точно определить, какой она длины – все промежуточные массы попадут в одну и ту же пробирку, некоторые из них могут не встретиться, некоторые — слиться друг с другом и т.д. Но всё же сэнгеровское секвенирование даёт отличные результаты с достаточно длинными ридами, которые потом относительно легко собирать. О том, как это делается, мы будем говорить в последующих текстах.

Именно при помощи сэнгеровского секвенирования был впервые расшифрован геном человека. Секвенирование по Сэнгеру применяется и сегодня, но его всё активнее вытесняют другие методы, и применяется оно всё реже. Кому же и почему оно уступило свои позиции?

Секвенаторы второго поколения: Illumina

Современные секвенаторы – это так называемые секвенаторы второго поколения (SGS, second generation sequencing). В них участки ДНК по-прежнему многократно клонируются, но процесс чтения устроен не так, как у Сэнгера. Существует много разных методов, отличающихся довольно существенно, поэтому мы рассмотрим только один из них, один из самых популярных на сегодня – секвенирование по методу Solexa (ныне Illumina; в смене названия не нужно искать глубокий смысл, просто одна компания купила другую).

Процесс секвенирования Illumina проиллюстрирован на рисунке; кроме того, можно посмотреть один из нескольких существующих видеороликов с анимацией этого процесса – в данном случае, действительно, лучше один раз увидеть, чем сто раз прочесть текст. Однако краткие комментарии тоже пригодятся; вот как происходит процесс секвенирования по методу Illumina.

(1)   Копии ДНК разрезаются в случайных местах на большое число небольших участков.

(2)   К каждому участку с двух сторон добавляют специальные адаптеры – заранее известные небольшие последовательности нуклеотидов.

(3)   Затем полученная смесь помещается на специально подготовленную подложку, из которой в виде решётки «растут» участки ДНК, комплементарные адаптерам. Таким образом, они способны «привязать» снабжённые адаптерами участки ДНК к этим местам. Кроме того, адаптеры также содержат праймеры, участки, к которым может присоединиться ДНК-полимераза, которая осуществляет репликацию ДНК.

(4)   На шаге 3 разные участки ДНК случайным образом «присасываются» к разным местам в решётке. Теперь мы многократно клонируем каждый участок вокруг своего места, получая тем самым целые «кластеры». Этот процесс известен как bridge amplification, потому что ДНК привязывается к подложке сразу двумя концами; о том, что это означает для биоинформатики, мы поговорим в следующем разделе.

(5)   Участки ДНК денатурируют (разрушают водородные связи) – в результате из узлов решётки на подложке «растут» разные участки ДНК, состоящие из одной нити.

(6)   Подложка помещается в раствор, содержащий ДНК-полимеразу и специально помеченные нуклеотиды, которые сразу же заканчивают процесс репликации (если помните, в сэнгеровском секвенировании такие тоже применялись). Они присоединяются к ДНК, по одному к каждому участку. Соответственно, к каждому участку присоединяется та «буква», с комплементарной к которой он начинается.

(7)   Затем «лишние» нуклеотиды смывают, а метки оставшихся считывают; в технологии Illumina это флуоресцентные метки, которые можно заставить светиться разным цветом и сфотографировать. Именно на этом шаге мы и узнаём, с какой буквы начинается каждый «кластер участков» ДНК.

(8)   После этого с уже связанных нуклеотидов химически «срезается» радикал, который мешал дальнейшей надстройке молекулы ДНК. Теперь можно вернуться на шаг 6 и повторить процесс, читая на втором цикле вторые буквы в каждой последовательности, и так далее.

В результате на каждом цикле мы прочитываем одновременно очень большое число нуклеотидов из разных последовательностей. Но за это приходится платить тем, что участки ДНК, которые мы можем прочесть, оказываются гораздо короче, чем в случае секвенирования по Сэнгеру – риды Illumina обычно получаются длиной около 100 нуклеотидов.

Парные риды и постановка задачи

Есть ещё одна важная деталь. Участки ДНК «присасываются» к подложке обоими концами, причём мы можем узнать, какие последовательности соответствуют одному и тому же участку. Это значит, что в реальности мы читаем один и тот же участок, длина которого нам приблизительно известна, сразу с двух сторон. В результате данные получаются примерно такого вида:

ATGCAGA???????????????CACTTTA,

причём расстояние между известными строчками (число вопросительных знаков) известно не совсем точно. В зависимости от технологии можно получить как очень длинные неизвестные фрагменты (около 1000 нуклеотидов), «обрамлённые» двумя ридами длины 100, так и короткие фрагменты, в которых неизвестны буквально два-три десятка нуклеотидов между ридами. И те, и другие могут очень помочь в сборке, и об этом мы тоже будем говорить в следующих сериях.

Итак, теперь мы можем формально поставить задачу сборки геномов. Она звучит так: по большому числу подстрок небольшой длины восстановить исходную длинную строку в алфавите из букв A, C, G, T. В случае секвенирования по методу Illumina – по большому числу пар коротких подстрок, разделённых в исходной строке приблизительно известным расстоянием. Поставив эту задачу, мы можем забыть про биологию, химию и медицину: перед нами чисто алгоритмическая задача. Однако прежде чем перейти к математике, сделаем ещё несколько замечаний.

Ошибки и показатели качества в секвенаторах второго поколения

Как мы уже знаем, секвенирование всегда содержит ошибки. В секвенаторах Illumina и аналогичных ошибки, как правило, происходят на фазе, когда нужно распознать помеченные нуклеотиды, т.е. понять, каким цветом и с какой силой светятся кластеры из многократно клонированных участков ДНК. На рисунке – типичный пример такой фотографии, порождённой секвенатором Illumina.

Проблема здесь заключается в том, что из-за неидеальности остальных этапов процесса кластеры никогда не светятся только одним цветом; это всегда смесь всех четырёх цветов с той или иной интенсивностью. Нужно выделить наиболее интенсивную компоненту и оценить, насколько вероятна ошибка в этой букве; эта задача называется base calling (распознавание нуклеотидов). Base calling – это целая наука, в подробности которой мы сейчас вдаваться не будем.

Для нас сейчас важно, что в результате каждому нуклеотиду каждого рида секвенатор ставит в соответствие вероятность того, что этот нуклеотид был распознан правильно. Эти вероятности тоже можно использовать при сборке, и секвенаторы выдают их вместе с собственно ридами.

В итоге типичный рид в так называемом fastq-формате, стандартном для секвенаторов второго поколения, выглядит примерно так:

@EAS20_8_6_1_3_25/1
GCAAAAAACTTACCCCGGAACAGGCCGAGCAGATCAAAACGCTACTGCAATACAGACCATCAAGCACCAACTCCCNNNCGTAGNNNNNNTATGTTNNNNG
+EAS20_8_6_1_3_25/1
HHHHHHHGHHHHHHHHHHHHHHHHHHHHEHHHHHHHHEGHHHHGHHGHEFD?A=A&FFBB>&::===@&@E@E>A#########################

Первая и третья строки содержат имя рида; вторая строка – сама последовательность нуклеотидов. Обратим внимание, что среди букв A, C, G, T встречаются и буквы N – это значит, что секвенатор не смог однозначно определить, какой здесь был нуклеотид, и сдался. А четвёртая строка кодирует в логарифмическом масштабе вероятности того, что тот или иной нуклеотид распознан правильно; например, H здесь соответствует вероятности ошибки около одной десятитысячной. Как правило, качество ухудшается к концу рида; в нашем примере, как видите, хвост рида и вовсе не удалось сколь-нибудь надёжно прочитать.

Другие методы секвенирования

Хотя мы подробнее всего рассмотрели секвенатор Illumina (Solexa), на самом деле на этом методе свет клином не сошёлся. Есть и другие секвенаторы второго поколения с другими свойствами.

В секвенировании лигированием (sequencing by ligation) на фазе, когда уже нужно распознавать нуклеотиды, используют не ДНК-полимеразу и процесс репликации, а специальные короткие «зонды», которые присоединяются к комплементарным нуклеотидам, фиксируются, затем вымываются, и процесс повторяется снова. Так устроен секвенатор SOLiD от Applied Biosystems.

Пиросеквенирование (pyrosequencing) основано на хемилюминесцентных сигналах, которые подают специально модифицированные нуклеотиды, когда соединяются с комплементарным нуклеотидом в прочитываемой нити ДНК; на этом принципе работает, например, секвенатор 454 от 454 Life Sciences.

Принцип работы секвенатора PacBio (от Pacific Biosciences) очень похож на принцип работы Illumina, но у него по-другому устроен метод детектирования – специальные «решётки» позволяют уловить сигналы от отдельных молекул (метод получил название SMRT, single molecule real time sequencing). Это позволяет ускорить процесс, уместить больше ридов на одной подложке (нужно меньше клонировать ДНК, не нужно выращивать большие кластеры) и существенно увеличить длину надёжно прочитываемых ридов.

Недавно появившийся метод ионного полупроводникового секвенирования (на нём основан секвенатор IonTorrent) вместо всего этого просто детектирует соединения (ионы), которые выделяются при присоединении нового нуклеотида к нити ДНК. Это позволяет радикально сократить время и стоимость получаемых ридов, хотя процент ошибок становится больше, и больше становится ошибок в фрагментах из повторяющейся одной буквы.

Человеческая мысль не стоит на месте: методы секвенирования постоянно улучшаются. Однако практически все современные методы выдают относительно короткие риды, от 100 до 400 нуклеотидов; в этом цикле мы будем в основном говорить о том, как собирать именно короткие риды.

Sanger или Illumina?

Человеческий геном был впервые собран на сэнгеровских секвенаторах, причём алгоритмическая сторона того проекта была проработана гораздо меньше, чем сейчас, десять лет спустя. Алгоритмы, которыми собирали первый человеческий геном, значительно проще тех, о которых мы будем говорить в дальнейшем. Однако первый геном всё-таки собрали; может быть, весь алгоритмический прогресс – это никому не нужный миф, и вполне хватило бы старых программ?

Невероятно, но факт: «старые» секвенаторы (первого поколения, сэнгеровские) выдают значительно более подходящие для сборки данные, чем «новые» (второго поколения). Это в основном выражается в длине ридов (reads) тех участков ДНК, которые удаётся последовательно прочесть и которые, собственно, и нужно собрать в одну большую строчку. Секвенаторы первого поколения выдавали риды длиной более пятисот нуклеотидов, обычно около тысячи. Современные секвенаторы выдают пары ридов, каждый из которых имеет длину около ста нуклеотидов.

Зачем же вообще использовать секвенаторы второго поколения, чем они лучше? Причина здесь, как это нередко бывает и в науке, и даже в медицине, чисто экономическая: современные секвенаторы гораздо дешевле. Проект по сборке первого человеческого генома, завершённый в 2003 году, занял 13 лет и стоил 3.8 миллиардов долларов. С тех пор цена секвенирования уменьшалась экспоненциально; «закон Мура в генетике» работает даже быстрее, чем обычный, и уменьшает цену каждые два года почти на порядок, так что, когда в 2010 году секвенировали геном самого Гордона Мура, это стоило уже всего лишь около $10 тысяч. Новые технологии секвенирования обещают научиться обрабатывать геном человека за $1000 и даже меньше, что открывает возможности для массового секвенирования в медицинских целях.

На таком уровне становится важной и цена алгоритмической стороны вопроса. Чтобы сборка геномов не занимала дольше и не стоила дороже, чем само их секвенирование, нужно разработать очень быстрые алгоритмы для решения задачи сборки. Об этом пойдет речь в следующей статье.

Литература:

Phillip E. C. Compeau, Pavel A. Pevzner. Genome Reconstruction: A
Puzzle with a Billion Pieces. In Bioinformatics for Biologists.

Pevzner P.A., Tang H., Waterman M.S. An Eulerian path approach to
DNA fragment assembly. Proc. Natl. Acad. Sci. USA, 98(17):9748-9753,
2001.

M.C. Schatz, A.L. Delcher, S. Salzberg. Assembly of large genomes
using second-generation sequencing. Genome Research, 20(9):1165-1173,
2010.

M.Chaisson, P. Pevzner, H. Tang. Fragment assembly with short
reads. Bioinformatics 20 (13): 2067-2074, 2004.

Сергей Николенко

кандидат физико-математических наук, старший научный сотрудник проблемной лаборатории вычислительной биологии СПбАУ РАН

Все материалы автора

Читать дальше
Twitter
Одноклассники
Мой Мир

материал с postnauka.ru

103
    +85 surfers

      Add

      You can create thematic collections and keep, for instance, all recipes in one place so you will never lose them.

      No images found
      Previous Next 0 / 0
      500
      • Advertisement
      • Animals
      • Architecture
      • Art
      • Auto
      • Aviation
      • Books
      • Cartoons
      • Celebrities
      • Children
      • Culture
      • Design
      • Economics
      • Education
      • Entertainment
      • Fashion
      • Fitness
      • Food
      • Gadgets
      • Games
      • Health
      • History
      • Hobby
      • Humor
      • Interior
      • Moto
      • Movies
      • Music
      • Nature
      • News
      • Photo
      • Pictures
      • Politics
      • Psychology
      • Science
      • Society
      • Sport
      • Technology
      • Travel
      • Video
      • Weapons
      • Web
      • Work
        Submit
        Valid formats are JPG, PNG, GIF.
        Not more than 5 Мb, please.
        30
        surfingbird.ru/site/
        RSS format guidelines
        500
        • Advertisement
        • Animals
        • Architecture
        • Art
        • Auto
        • Aviation
        • Books
        • Cartoons
        • Celebrities
        • Children
        • Culture
        • Design
        • Economics
        • Education
        • Entertainment
        • Fashion
        • Fitness
        • Food
        • Gadgets
        • Games
        • Health
        • History
        • Hobby
        • Humor
        • Interior
        • Moto
        • Movies
        • Music
        • Nature
        • News
        • Photo
        • Pictures
        • Politics
        • Psychology
        • Science
        • Society
        • Sport
        • Technology
        • Travel
        • Video
        • Weapons
        • Web
        • Work

          Submit

          Thank you! Wait for moderation.

          Тебе это не нравится?

          You can block the domain, tag, user or channel, and we'll stop recommend it to you. You can always unblock them in your settings.

          • PostNauka
          • домен postnauka.ru

          Get a link

          Спасибо, твоя жалоба принята.

          Log on to Surfingbird

          Recover
          Sign up

          or

          Welcome to Surfingbird.com!

          You'll find thousands of interesting pages, photos, and videos inside.
          Join!

          • Personal
            recommendations

          • Stash
            interesting and useful stuff

          • Anywhere,
            anytime

          Do we already know you? Login or restore the password.

          Close

          Add to collection

             

            Facebook

            Ваш профиль на рассмотрении, обновите страницу через несколько секунд

            Facebook

            К сожалению, вы не попадаете под условия акции